NIH logo
Searching for motif id 8588

Entry # 8588: 1Y69_j8_0-G42_0-G115_0-C128_0-U142_0-A153_0-G192_0-A239_0-C439

Primary Citation: (from PDB entry 1Y69)

D.N.WILSON F.SCHLUENZEN J.M.HARMS T.YOSHIDA T.OHKUBO R.ALBRECHT J.BUERGER Y.KOBAYASHI P.FUCINI . X-RAY CRYSTALLOGRAPHY ON RIBOSOME RECYCLING: MECHANISM OF BINDING AND ACTION OF RRF ON THE 50S RIBOSOMAL SUBUNIT EMBO J. V. 24 251 2005

Experimental Method: X-RAY_DIFFRACTION

Structure Images
3d structure of junction secondary structure of junction

Click to launch 3D viewer Jmol | Larger 3D image | Created with Raster3D and RNAView

Derived Information
Type:8-wayCluster:1Y69 j8 0-G42 0-G115 0-C128 0-U142 0-A153 0-G192 0-A239 0-C439 
NC-IUBMB Classification:Cluster Page
Angles: 15:16:22:41:43:68:70:72:83:87:87:89:98:99:100:101:103:106:114:115:134:134:143:152:154:158:168:173°
Fit Criteria: B
Extracted Structure:Download
Minimized Structure:Download RMSD = 1.10445Å

For more detailed information view the raw JunctionScanner output.

Sequence

Strand 1: Chain 0: CCGAAUGGG 9nt

Strand 2: Chain 0: UGGAGCCGAUGAAGG 15nt

Strand 3: Chain 0: CCCACC 6nt

Strand 4: Chain 0: GGUAUCC 7nt

Strand 5: Chain 0: GGAUGGGAAC 10nt

Strand 6: Chain 0: AGGAGAAGAAAGAGAAUUCGAUUCC 25nt

Strand 7: Chain 0: GGAUCAGCC 9nt

Strand 8: Chain 0: GGCUAAAUACUCCCA 15nt

Valid XHTML 1.0 Transitional