Searching for motif id 7667

Entry # 7667: 1VQP_j2_0-C1104_0-A1230

Primary Citation: (from PDB entry 1VQP)

T.M.SCHMEING T.A.STEITZ . STRUCTURAL INSIGHTS INTO THE ROLES OF WATER AND THE 2' HYDROXYL OF THE P SITE TRNA IN THE PEPTIDYL TRANSFERASE REACTION. MOL.CELL V. 20 437 2005

Experimental Method: X-RAY_DIFFRACTION

Structure Images
3d structure of junction secondary structure of junction

Click to launch 3D viewer Jmol | Larger 3D image | Created with Raster3D and RNAView

Derived Information
Type:Bulge LoopCluster:1KC8 j2 A-C1104 A-A1230 
NC-IUBMB Classification:HS8HS27Cluster Page
Angles: 64°
Fit Criteria: C
Extracted Structure:Download
Minimized Structure:Download RMSD = 0.93839Å

For more detailed information view the raw JunctionScanner output.

Sequence

Strand 1: Chain 0: CCCAAGUGUGGAUUAAGUGUAAUCCUCUGAA 31nt

Strand 2: Chain 0: CAAAAUGAUCGG 12nt

Valid XHTML 1.0 Transitional