NIH logo

Entry # 4183: 1NKW_j2_0-C1027_0-G1136

Primary Citation: (from PDB entry 1NKW)

J.M.HARMS F.SCHLUENZEN R.ZARIVACH A.BASHAN S.GAT I.AGMON H.BARTELS F.FRANCESCHI A.YONATH HIGH RESOLUTION STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM A MESOPHILIC EUBACTERIUM CELL (CAMBRIDGE,MASS.) V. 107 679 2001

Experimental Method: X-RAY_DIFFRACTION

Structure Images
3d structure of junction secondary structure of junction

Click to launch 3D viewer Jmol | Larger 3D image | Created with Raster3D and RNAView

Derived Information
Type:Bulge LoopCluster:1NKW j2 0-C1027 0-G1136 
NC-IUBMB Classification:HS12HS20Cluster Page
Angles: 116°
Fit Criteria: A
Extracted Structure:Download
Minimized Structure:Download RMSD = 1.09585Å

For more detailed information view the raw JunctionScanner output.

Sequence

Strand 1: Chain 0: CCGAAAAUGAUCGGGGCUCAAGUGAU 26nt

Strand 2: Chain 0: AUCGCUCAGUGGUUAAGG 18nt

Valid XHTML 1.0 Transitional