NIH logo
Searching for motif id 147

Entry # 147: 1C2W_j6_B-C817_B-C835_B-G940_B-G971_B-G1163_B-G1185

Primary Citation: (from PDB entry 1C2W)

R.BRIMACOMBE F.MUELLER : MUELLER . THE 3D ARRANGEMENT OF THE 23S AND 5S RRNA IN THE ESCHERICHIA COLI 50S RIBOSOMAL SUBUNIT BASED ON A CRYO-ELECTRON MICROSCOPIC RECONSTRUCTION AT 7.5 ANGSTROMS RESOLUTION J.MOL.BIOL. V. 298 35 2000

Experimental Method: ELECTRON_MICROSCOPY

Structure Images
3d structure of junction secondary structure of junction

Click to launch 3D viewer Jmol | Larger 3D image | Created with Raster3D and RNAView

Derived Information
Type:6-wayCluster:1C2W j6 B-C817 B-C835 B-G940 B-G971 B-G1163 B-G1185 
NC-IUBMB Classification:Cluster Page
Angles: 5:13:22:23:35:36:71:125:126:127:139:148:160:160:161°
Fit Criteria: A
Extracted Structure:Download
Minimized Structure:Download RMSD = 2.32655Å

For more detailed information view the raw JunctionScanner output.

Sequence

Strand 1: Chain B: AGCGCCUC 8nt

Strand 2: Chain B: CCCGAAAGCU 10nt

Strand 3: Chain B: GGGAGACACAC 11nt

Strand 4: Chain B: GUGAAGAGGGAAACAACCCAGACCG 25nt

Strand 5: Chain B: CGGCAG 6nt

Strand 6: Chain B: UUGGGUAGGG 10nt

Valid XHTML 1.0 Transitional