NIH logo
Searching for motif id 13051

Entry # 13051: 1Z58_k2_2-G963_2-C2239

Primary Citation: (from PDB entry 1Z58)

M.AMIT R.BERISIO D.BARAM J.HARMS A.BASHAN A.YONATH . A CREVICE ADJOINING THE RIBOSOME TUNNEL: HINTS FOR COTRANSLATIONAL FOLDING. FEBS LETT. V. 579 3207 2005

Experimental Method: X-RAY_DIFFRACTION

Structure Images
3d structure of junction secondary structure of junction

Click to launch 3D viewer Jmol | Larger 3D image | Created with Raster3D and RNAView

Derived Information
Type:Kissing-loopCluster:1Z58 k2 2-G963 2-C2239 
NC-IUBMB Classification:N/ACluster Page
Angles: 104°
Fit Criteria: C
Extracted Structure:Download

For more detailed information view the raw JunctionScanner output.

Sequence

Strand 1: Chain 2: CGAGAGCUAACUUCCG 16nt

Strand 2: Chain 2: GCCUCCCAAAAUGUAACGGAGGC 23nt

Valid XHTML 1.0 Transitional