here

here in JunctionPage beginning

DEBUG: In ./functions/functions.php, in function sanitate. In function sanitate_rnajunction. RNAJunction Database - Junction Profile:13020

NIH logo
Searching for motif id 13020

Entry # 13020: 1XBP_k2_0-G423_0-U2377

Primary Citation: (from PDB entry 1XBP)

F.SCHLUENZEN E.PYETAN P.FUCINI A.YONATH J.M.HARMS . INHIBITION OF PEPTIDE BOND FORMATION BY PLEUROMUTILINS: THE STRUCTURE OF THE 50S RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS IN COMPLEX WITH TIAMULIN. MOL.MICROBIOL. V. 54 1287 2004

Experimental Method: X-RAY_DIFFRACTION

Structure Images
3d structure of junction secondary structure of junction

Click to launch 3D viewer Jmol | Larger 3D image | Created with Raster3D and RNAView

Derived Information

DEBUG: In JunctionPage.php: row2 = row[2] = 2

DEBUG: In JunctionPage.php: cluster = row[14] = 1XBP.rnaview.pdb_k2_0-G423_0-U2377.pdb

DEBUG: In JunctionPage.php: Variable PHP_INT_MAX used by PHP function explode = 2048

Type:Kissing-loopCluster:1XBP k2 0-G423 0-U2377 
NC-IUBMB Classification:N/ACluster Page
Angles: 128°
Fit Criteria: A
Extracted Structure:Download

For more detailed information view the raw JunctionScanner output.

Sequence

Strand 1: Chain 0: GCGGACCACCGC 12nt

Strand 2: Chain 0: GGUGGUACCGUGUGGAAGGGCCAUC 25nt

Valid XHTML 1.0 Transitional