NIH logo
Searching for motif id 10829

Entry # 10829: 2GYA_j6_0-G818_0-C835_0-A941_0-G971_0-G1163_0-G1185

Primary Citation: (from PDB entry 2GYA)

K.MITRA J.FRANK . ELONGATION ARREST BY SECM VIA A CASCADE OF RIBOSOMAL RNA REARRANGEMENTS MOL.CELL V. 22 533 2006

Experimental Method: ELECTRON_MICROSCOPY

Structure Images
3d structure of junction secondary structure of junction

Click to launch 3D viewer Jmol | Larger 3D image | Created with Raster3D and RNAView

Derived Information
Type:6-wayCluster:2GYA j6 0-G818 0-C835 0-A941 0-G971 0-G1163 0-G1185 
NC-IUBMB Classification:Cluster Page
Angles: 41:42:45:68:71:88:103:109:111:127:132:140:144:164:174°
Fit Criteria: A
Extracted Structure:Download
Minimized Structure:Download RMSD = 1.35645Å

For more detailed information view the raw JunctionScanner output.

Sequence

Strand 1: Chain 0: AGCGCCU 7nt

Strand 2: Chain 0: CCGAAAGCU 9nt

Strand 3: Chain 0: GGAGACACAC 10nt

Strand 4: Chain 0: GUGAAGAGGGAAACAACCCAGACCG 25nt

Strand 5: Chain 0: CGGCAG 6nt

Strand 6: Chain 0: UUGGGUAGG 9nt

Valid XHTML 1.0 Transitional